tebu-bio is a European company specialised in providing innovative reagents and laboratory services in Life Sciences
X

Need an answer now?

Give us a call

Leave a message, we'll get back to you





Move

Product added to your basket !


Continue your visit View your basket
24rxn EUR 138
138€


Contact us

Recent History

Index Primer Set 1

Product name
Index Primer Set 1
Catalog number
L-3204-24 (24rxn)
Description
Primers 1-12 with RT and Forward PCR PrimerRT Primer:-GCCTTGGCACCCGAGAATTCCA-Forward Primer:-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-Index 1 Primer:-CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA-...-Index 12 Primer:-CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA 
Source
Trilink Biotechnologies
Product category
Genomics
Product sub category
PCR
Shipment info
Dry Ice
Nacres Codification
NA.55

Request the Datasheet

First name
Last name
Email *
Country *:
Company name
  
* Fields marked with an asterisk are required.



Protocol

To access the protocol, please provide your email address :