Download the miRNA flyer for further information.
Simultaneous detection of genome-wide or pathway-focused miRNA
The RT² miRNA PCR Array accurately analyzes the expression of multiple micro RNA sequences at the same time on ANY real-time PCR instrument. SABiosciences' patent-pending miRNA technology ingeniously integrates a universal tailing and reverse transcription reaction specific for miRNA with the accurate expression level measurement of distinct miRNA sequences that may only differ by a single nucleotide base. With this technology, you can easily get a comprehensive survey of miRNA expression in your cell line or tissue of interest.
- Sensitivity: As little as 0.5 µg total RNA needed
- Multi-Sequence Flexibility: Analyze up to 376 sequences simultaneously
- Simplicity: As easy as a real-time PCR experiment
Each 96- or 384-well plate contains SYBR Green optimized and experimentally validated assays for either the entire human miRNA genome or pathway-focused sets of human miRNA sequences.
Available miRNA PCR Arrays
| Designation | Species | Cat nr | |
| RT2 Cancer miRNA PCR Arrays | Human Mouse |
MAH-102 MAM-102 |
|
| RT2 cell differentiation & development miRNA PCR Arrays | Human Mouse |
MAH-103 MAM-103 |
|
| RT2 miFinder miRNA PCR Arrays | Human Mouse |
MAH-001 MAM-001 |
|
| Genome RT2 miRNA PCR Arrays (96-well plate) | Human Mouse |
MAH-100A MAM-100A |
|
| Genome RT2 miRNA PCR Arrays (384-well plate) | Human Mouse |
MAH-3100A MAM-3100A |
* RT2 qPCR-grade miRNA isolation Kit (Cat nr MA-01)
* RT2 miRNA First strand Kit (Cat nr MA-03)
* RT2 qPCR MasterMix w/ SYBR Green/Rox
(Cat nr PA-012)
* RT2 qPCR MasterMix w/ SYBR Green/Fluorescein
(Cat nr PA-011)
* RT2 qPCR MasterMix w/ SYBR Green only
(Cat nr PA-010)
Single nucleotide mismatch discrimination
RT² miRNA Assay Design Improves Discrimination & Specificity. The proprietary primer design of the RT² miRNA PCR Array and Assays distinguishes miRNA family members with single nucleotide mismatches providing greater discrimination and specificity than other commercial providers.
| Synthetic miRNA Template |
Assay Primers | Relative Detection (%Perfect Match) |
miRNA Template Sequence |
| miR-10a | miR-10a | 100.00 | UACCCUGUAGAUCCGAAUUUGUG |
| miR-10b | 0.98 | ||
| miR-10b | miR-10b | 100.00 | UACCCUGUAGAACCGAAUUUGUG |
| miR-10a | 0.01 | ||
| miR-99a | mir-99a | 100.00 | AACCCGUAGAUCCGAUCUUGUG |
| miR-100 | 0.54 | ||
| miR-100 | miR-100 | 100.00 | AACCCGUAGAUCCGAACUUGUG |
| mir-99a | 0.07 | ||
| miR-196a | miR-196a | 100.00 | UAGGUAGUUUCAUGUUGUUGGG |
| miR-196b | 0.20 | ||
| miR-196b | miR-196b | 100.00 | UAGGUAGUUUCCUGUUGUUGGG |
| miR-196a | 1.64 | ||
|
Relative detection as a percent of the perfect match (100 x 2- ΔΔCt) is calculated from the Ct values of target and off-target assays used to detect 105 copies of synthetic miRNA template. The observed cross-reactivity seen between RT² miRNA qPCR Assays for different miRNA species are compared. |
|||
Distinction between mature miRNA and their precursors
Specifically detecting mature miRNA improves sensitivity. The patent-pending chemistry of the RT² miRNA First Strand Kit preferentially reverse transcribes mature miRNA, thereby decreasing non-specific background and increasing sensitivity. The RT² miRNA PCR Assays provide three orders of magnitude greater sensitivity than competing assays. Other assays can amplify non-specific products that tend to be more evident at lower amounts of input material.

Synthetic mir-658 was serially diluted into a constant amount (100 ng) of small RNA enriched from 293H cells lacking that sequence. Samples were analyzed with mir-658-specific RT² miRNA qPCR Assays and other commercial assays. The resulting threshold cycles of the assays are plotted versus the log10 of the number of mir-658 template copies.

Send to a friend
Print
Top
website map
contact us
legal information

