tebu-bio is a European company specialised in providing innovative reagents and laboratory services in Life Sciences
X

Need an answer now?

Give us a call

01 30 46 39 00

Leave a message, we'll get back to you





Move

Product added to your basket !


Continue your visit View your basket
3nmol EUR 189
189€
3x3nmol EUR 510
510€


Contact us

Recent History

3' iCLIP Primer

Product name
3' iCLIP Primer
Catalog number
O-30050-03 (3nmol)
O-30050-09 (3x3nmol)
Description
Preadenylated L3 Linker. A synthetic PAGE-purified, lyophilized oligonucleotide with the sequence: /5rApp/AGATCGGAAGAGCGGTTCAG/3ddC 
Product category
Transcriptomics
Product sub category
RNA Sequencing
Shipment info
Dry Ice
Source
Trilink Biotechnologies

Download the datasheet

Download the PDF datasheet

Protocol

To access the protocol, please provide your email address :